View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_51 (Length: 298)
Name: NF10466_low_51
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 173 - 281
Target Start/End: Complemental strand, 8807689 - 8807581
Alignment:
| Q |
173 |
cctccaacaagtgcaaacaaaactagttgaaccacctatgcttccaaaaaattcatgcaatgaaacatgtggaaaactccatgttccatttccattctac |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807689 |
cctccaacaagtgcaaacaaaactagttgaaccacctttgcttccaaaaaattcatgcaatgaaacatgtggaaaactccatgttccatttccattctac |
8807590 |
T |
|
| Q |
273 |
atcaacaac |
281 |
Q |
| |
|
||||||||| |
|
|
| T |
8807589 |
atcaacaac |
8807581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 14 - 119
Target Start/End: Complemental strand, 8807848 - 8807743
Alignment:
| Q |
14 |
atgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgtcactgccactgctactagcaatgtttaatgttgttgtcctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807848 |
atgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgtccctgccactgctactagcaatgtttaatgttgttgtcctc |
8807749 |
T |
|
| Q |
114 |
atgaaa |
119 |
Q |
| |
|
|||||| |
|
|
| T |
8807748 |
atgaaa |
8807743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University