View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_60 (Length: 270)
Name: NF10466_low_60
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 4284398 - 4284170
Alignment:
| Q |
1 |
aatggtttcaatagatagaactggtgctttttctctttcggatagtagaaatggtgatggtgttgagatgggttttgtgtctaacaaaaaagcaatggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| || ||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
4284398 |
aatggtttcaatagatagaactggtgccttttgtctttctgactgtagaaatggtgatggtgttgagataggtttcgtgtctaactaaaaagcaatggaa |
4284299 |
T |
 |
| Q |
101 |
gcttttgcttcgctctttgtcaaaggcattgcatcttgagtttcatcatgtatatgtgt--actttattggtttgcaggaatactttttctttgatg-tt |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| ||| | ||| ||| || |
|
|
| T |
4284298 |
gtttttgcttcgctctttgtcaaaggcattgcatcttgagtttcttcatgtgtatgtgtaaactttattggtttgcaggaataatttat-tttaatgttt |
4284200 |
T |
 |
| Q |
198 |
tttcattctataaattacatataatttgaaag |
229 |
Q |
| |
|
|||| |||||||| || |||||||||||||| |
|
|
| T |
4284199 |
tttctttctataattt--atataatttgaaag |
4284170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 117 - 254
Target Start/End: Original strand, 4261645 - 4261784
Alignment:
| Q |
117 |
ttgtcaaaggcattgcatcttgagtttcatcatgtatatgtgta--ctttattggtttgcaggaatactttttctttgatgtttttcattctataaatta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261645 |
ttgtcaaaggcattgcatcttgagtttcatcatgtgtatgtgtagactttattggtttgcaggaatactttttctttgatgtttttcattctataaatta |
4261744 |
T |
 |
| Q |
215 |
catataatttgaaagtcttgacacatcttgtgcttggttc |
254 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4261745 |
catataatttgaaagtcttgtcacatcttgtgcttggttc |
4261784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 4261080 - 4261205
Alignment:
| Q |
1 |
aatggtttcaatagatagaactggtgctttttctctttcggatagtagaaatggtgatggtgttgagatgggttttgtgtctaacaaaaaagcaatggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4261080 |
aatggtttcaatagatagaactggtgctttttgtctttctgatagtagaaatggtgatggtgttgagataggttttgtgtctaacaaaaaagcaatggaa |
4261179 |
T |
 |
| Q |
101 |
gcttttgcttcgctctttgtcaaagg |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4261180 |
gcttttgcttcgctctttgtcaaagg |
4261205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 4289097 - 4288956
Alignment:
| Q |
1 |
aatggtttcaatagatagaactggtgctttttctctttcggatagtagaaatggtgatggtgttgagatgggttttgtgtctaacaaaaaagcaatggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4289097 |
aatggtttcaatagatagaactggtgccttttgtctttctgattgtagaaagggtgatggtgttgagataggttttgtgtctaacaaaaaagcaatggaa |
4288998 |
T |
 |
| Q |
101 |
gcttttgcttcgctctttgtcaaaggcattgcatcttgagtt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4288997 |
tcttttgcttcgctctttgtcaaaggcattgcatcctgagtt |
4288956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 4297692 - 4297533
Alignment:
| Q |
1 |
aatggtttcaatagatagaactggtgctttttctctttcggatagtagaaatggtgatggtgttgagatgggttttgtgtctaacaaaaaagcaatggaa |
100 |
Q |
| |
|
||||||||| |||||||||| |||||| |||| |||||| ||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4297692 |
aatggtttctatagatagaattggtgccttttgtctttctgattgtagaaagggtgatggtgttgagataggttttgtgtctaacaaaaaagcaatggaa |
4297593 |
T |
 |
| Q |
101 |
gcttttgcttcgctctttgtcaaaggcattgcatcttgagtttcatcatgtatatgtgta |
160 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| ||||| |||||||| |
|
|
| T |
4297592 |
gcttttgcttcgctctttgtcaaaggaattgcatcatgagtttctacatgtgtatgtgta |
4297533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 4266626 - 4266766
Alignment:
| Q |
1 |
aatggtttcaatagatagaactggtgctttttctctttcggatagtagaaatggtgatggtgttgagatgggttttgtgtctaacaaaaaagcaatggaa |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||| || | ||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
4266626 |
aatggtttctatagatagaactggtgcttattgtgtttcggatagtagtaatggtgatggtgttgagataggttttgtgtctacgaaaaaagcaatggaa |
4266725 |
T |
 |
| Q |
101 |
gcttttgcttcgctctttgtcaaaggcattgcatcttgagt |
141 |
Q |
| |
|
|| |||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
4266726 |
gcctttgcttctctctttgtcaaagggattggatcttgagt |
4266766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 5 - 141
Target Start/End: Complemental strand, 4255389 - 4255252
Alignment:
| Q |
5 |
gtttcaatagatagaactggtgctttttctctttcggatagtagaaatggtgatggtgttgagatgggttttgtgtcta-acaaaaaagcaatggaagct |
103 |
Q |
| |
|
||||| ||| ||| ||||||||| |||| ||||| ||| ||||||||||||||||||||||||| || || |||| || | ||||||||||||||||| |
|
|
| T |
4255389 |
gtttctataaataaaactggtgccttttgtctttaagattgtagaaatggtgatggtgttgagataggattcgtgtttacaaaaaaaagcaatggaagcc |
4255290 |
T |
 |
| Q |
104 |
tttgcttcgctctttgtcaaaggcattgcatcttgagt |
141 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4255289 |
tttgcttttctctttgtcaaaggcattgcatcttgagt |
4255252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University