View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_63 (Length: 257)
Name: NF10466_low_63
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 34564093 - 34564321
Alignment:
| Q |
11 |
cagagacgaaatctagacatcgatttggttcaaacaaccgattcagtgacttattttgtgactagtacacatgatcaaaagtcttgtctcacctaaccta |
110 |
Q |
| |
|
|||||||||||| | |||| |||||||||| ||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34564093 |
cagagacgaaatgtggacaccgatttggttgaaacagccaattcagtgacttattttgtgactagtacacacgatcaaaagtcttgtctcacctaaccta |
34564192 |
T |
 |
| Q |
111 |
gaacatctgctactacttcatcacatgaaacatctcaagttgcatcccttccaagtacatcttatataacacctccaccttccataagaggggtagatta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
34564193 |
gaacatctgctactacttcatcacatgaaacatctcaagttgcatcccttccaagtacatcttatgtaacacctccaccttccattagaggtgtagatta |
34564292 |
T |
 |
| Q |
211 |
caccatcagttccacaaccatgtcattta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34564293 |
caccatcagttccacaaccatgtcattta |
34564321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University