View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_68 (Length: 250)
Name: NF10466_low_68
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 40114255 - 40114012
Alignment:
| Q |
1 |
ttgcattaggaacagcaaagggtatattatatcttcatgagggttgtcaaaaaagatttatccacagagatataaaagctgcaaatatcttgctcacaga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40114255 |
ttgcattaggaacagcaaaaggtatattatatcttcatgagggttgtcaaaaaagatttatccacagagatataaaagctgcaaatatcttgctcacaga |
40114156 |
T |
|
| Q |
101 |
ggactttgagcctcaggtatatatgctttggattcttttatagtatttttgtgtttaccttatagacaaaatacaattttttggaagattctgcattata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40114155 |
ggactttgagcctcaggtatatatgctttggattcttttatagtatttttgtgtttaccttatagacaaaatacaattttttggaagattctgcattata |
40114056 |
T |
|
| Q |
201 |
tgtgatggaccaaatctttctttcaacatcacctttcttctctc |
244 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
40114055 |
tgtgatggaccaaatctctctttcaacatcacctttcttgtctc |
40114012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 118
Target Start/End: Complemental strand, 6987932 - 6987844
Alignment:
| Q |
30 |
tatcttcatgagggttgtcaaaaaagatttatccacagagatataaaagctgcaaatatcttgctcacagaggactttgagcctcaggt |
118 |
Q |
| |
|
||||| |||||||| ||||||| ||| |||| |||| |||||| |||||| | ||||| | ||| |||||||||||||||||||||| |
|
|
| T |
6987932 |
tatctgcatgagggatgtcaaagaaggattattcacaaagatatcaaagcttctaatatacttctctcagaggactttgagcctcaggt |
6987844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University