View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_70 (Length: 250)
Name: NF10466_low_70
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 2893510 - 2893274
Alignment:
| Q |
1 |
tcgtcttgggttatgtgaaatgtgtctcttggagtggtttcgtcggtgttagggttacggcgtttgttgttggttctgttgtcatcaacgctgttgtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2893510 |
tcgtcttgggttatgtgaaatgtgtctcttggagtggtttcgtcggtgttagggttacggcgtttgttgttggttctgttgtcatcaacgctgttgtgtg |
2893411 |
T |
 |
| Q |
101 |
agtgtgaacgtttgttgccataggatgttctttgaccagccattgttttgtgtgagaactgtgtttgtgaattatgattttagggttttatctatctaac |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
2893410 |
agtgtgaacgtttgttgccgtaggatgttctttgaccagccattattttgtgtgagaattgtgtttgtgaattgtgagtttagggttttatctatctaac |
2893311 |
T |
 |
| Q |
201 |
atacactttgccgacttagttttttgctttcttgttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2893310 |
atacactttgccgacttagttttttgctttcttgttc |
2893274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University