View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_98 (Length: 221)
Name: NF10466_low_98
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_98 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 39267848 - 39268051
Alignment:
| Q |
1 |
ccagcccgacccgataagcctgaactggtttgttcactcttctgcacaccacgtgtttgttttaatttttgataacccattagatgcatgatttgcctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39267848 |
ccagcccgacccgataagcctgaactggtttgttcactcttctgcacaccacgtgtttgttttaatttttgataacccattagatgcatgatttgcctaa |
39267947 |
T |
|
| Q |
101 |
gatacagataactatggtaagatgcataatgaattggttttctttgatttcaggtttctactaaggaaattcctgctcctaaaaactcgggtttgccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39267948 |
gatacagataactatggtaagatgcataatgaattggttttctttgatttcaggtttctactaaggaaattcctgctcctaaaaactcgggtttgccttt |
39268047 |
T |
|
| Q |
201 |
gaat |
204 |
Q |
| |
|
|||| |
|
|
| T |
39268048 |
gaat |
39268051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University