View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10467_high_8 (Length: 215)
Name: NF10467_high_8
Description: NF10467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10467_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 203
Target Start/End: Complemental strand, 2640038 - 2639957
Alignment:
| Q |
122 |
tcaacatacaagcatatcattgtgatatcagtgtcactcaggtttaacacatacataccatatttaattgtgcatattttga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2640038 |
tcaacatacaagcatatcattgtgatatcagtgtccctcaggtttaacacatacataccatatttaattgtgcatattttga |
2639957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 37665085 - 37665004
Alignment:
| Q |
21 |
agcatgcctttcaccactttctctctgatgaagttgaatctagtctttatatgatttcttctaccatgtgcaataggatttt |
102 |
Q |
| |
|
||||| ||||| | |||||||||||||||||||| ||| || |||| |||||| || |||||| ||||||||||||||||| |
|
|
| T |
37665085 |
agcattcctttgatcactttctctctgatgaagtggaaccttgtctctatatgtttgcttctataatgtgcaataggatttt |
37665004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 96
Target Start/End: Complemental strand, 8543884 - 8543809
Alignment:
| Q |
21 |
agcatgcctttcaccactttctctctgatgaagttgaatctagtctttatatgatttcttctaccatgtgcaatag |
96 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||| |||||||||| | |||| || ||||||||||||| ||||| |
|
|
| T |
8543884 |
agcatgcctttcatcacttggtctctaatgaagtgaaatctagtctctttatgcttgcttctaccatgtggaatag |
8543809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 28734827 - 28734909
Alignment:
| Q |
12 |
atgactttgagcatgcctttcaccactttctctctgatgaagttgaatctagtctttatatgatttcttctaccatgtgcaat |
94 |
Q |
| |
|
|||| ||| ||||| ||||||| ||||| |||||||||||||| ||||||| | |||||| || ||||| ||||||||||| |
|
|
| T |
28734827 |
atgattttcagcattcctttcatcacttgctctctgatgaagtgaaatctaggccatatatgcttgcttcttccatgtgcaat |
28734909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University