View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10467_low_12 (Length: 215)

Name: NF10467_low_12
Description: NF10467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10467_low_12
NF10467_low_12
[»] chr7 (1 HSPs)
chr7 (122-203)||(2639957-2640038)
[»] chr4 (1 HSPs)
chr4 (21-102)||(37665004-37665085)
[»] chr6 (1 HSPs)
chr6 (21-96)||(8543809-8543884)
[»] chr8 (1 HSPs)
chr8 (12-94)||(28734827-28734909)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 203
Target Start/End: Complemental strand, 2640038 - 2639957
Alignment:
Q  122 tcaacatacaagcatatcattgtgatatcagtgtcactcaggtttaacacatacataccatatttaattgtgcatattttga 203  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  2640038 tcaacatacaagcatatcattgtgatatcagtgtccctcaggtttaacacatacataccatatttaattgtgcatattttga 2639957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 37665085 - 37665004
Alignment:
Q  21 agcatgcctttcaccactttctctctgatgaagttgaatctagtctttatatgatttcttctaccatgtgcaataggatttt 102  Q
    ||||| ||||| | |||||||||||||||||||| ||| || |||| |||||| || ||||||  |||||||||||||||||    
T  37665085 agcattcctttgatcactttctctctgatgaagtggaaccttgtctctatatgtttgcttctataatgtgcaataggatttt 37665004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 96
Target Start/End: Complemental strand, 8543884 - 8543809
Alignment:
Q  21 agcatgcctttcaccactttctctctgatgaagttgaatctagtctttatatgatttcttctaccatgtgcaatag 96  Q
    ||||||||||||| |||||  ||||| |||||||  |||||||||| | |||| || ||||||||||||| |||||    
T  8543884 agcatgcctttcatcacttggtctctaatgaagtgaaatctagtctctttatgcttgcttctaccatgtggaatag 8543809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 28734827 - 28734909
Alignment:
Q  12 atgactttgagcatgcctttcaccactttctctctgatgaagttgaatctagtctttatatgatttcttctaccatgtgcaat 94  Q
    |||| ||| ||||| ||||||| ||||| ||||||||||||||  ||||||| |  |||||| || ||||| |||||||||||    
T  28734827 atgattttcagcattcctttcatcacttgctctctgatgaagtgaaatctaggccatatatgcttgcttcttccatgtgcaat 28734909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University