View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10467_low_4 (Length: 274)
Name: NF10467_low_4
Description: NF10467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10467_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 258
Target Start/End: Complemental strand, 10748274 - 10748024
Alignment:
| Q |
8 |
gagagggtatcatctcatctcatcagcatgnnnnnnnacaatgtttgcatatatgtagggacctgagctatacgcagaaagtggattaacaatctttcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10748274 |
gagagggtatcatctcatctcatcagcatgtttttttacaatgtttgcatatatgtagggacctgagctatacgcagaaagtggattaacagtctttcca |
10748175 |
T |
|
| Q |
108 |
ttgcaattagaggcaaagaataagcccatgtatggtgctggaagaagcatggaggatatgctagattctggaagaggattaccaatattgatacaagtaa |
207 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10748174 |
ttgcaattagaggtaaagaataagcccatgtatggtgctggaagaagcatggaggatatgctagattctggaagaggattaccaatattgatacaagtaa |
10748075 |
T |
|
| Q |
208 |
ccttgagttcaagttttgaagttgtgccagcacttgtaaagcctaagttcc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10748074 |
ccttgagttcaagttttgaagttgtgccagcacttgtaaagcctaagttcc |
10748024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University