View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10467_low_9 (Length: 243)
Name: NF10467_low_9
Description: NF10467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10467_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 28741851 - 28741710
Alignment:
| Q |
1 |
ccctgttttgggttcgttggattgtgtgtgtacctatcttctaggcatt-gggctctttactagatttttgtcctattttttatataccactcttgttat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28741851 |
ccctgttttgggttcgttggattgtgtgtgtacctatcttctaggcatttgggctctttactagatttttgtcctattttttatataccacttttgttat |
28741752 |
T |
|
| Q |
100 |
tctctgtttattacccgtttagggatgttattgttttcatgg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28741751 |
tctctgtttattacccgtttagggatgttgttgttttcatgg |
28741710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 229
Target Start/End: Complemental strand, 28741712 - 28741667
Alignment:
| Q |
184 |
tggatgaacaaccaccttcttgatcgatcgaggttagggaagagtt |
229 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28741712 |
tggatgaacaaccaccttctcgattgatcgaggttagggaagagtt |
28741667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University