View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_high_11 (Length: 375)
Name: NF10468_high_11
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_high_11 |
 |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 17 - 366
Target Start/End: Complemental strand, 30599286 - 30598939
Alignment:
| Q |
17 |
acattccatgttggggtatccctctgtatagccccactagcctttaaactaggcgacaagtttttgatgcgcatgcattgtgagaccaactatgttgtag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30599286 |
acattccatgttggggtatccctctgtatagccccactagcctttaaactaggtgacaagtttctgatgcgcat-cattgtgagaccaactatgttgtag |
30599188 |
T |
 |
| Q |
117 |
gacctccatcctcttttgcataacagatttgaatgcatatatatcttcacgctccttgtagccgtcatatgaagggagcagtgttcattttcagtctttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30599187 |
aacctccatcctcttttgcataacagatttgaatgcatatatatcttcacgctccttgtagccgtcatatgaagggagcagtgttcattttcagtctttg |
30599088 |
T |
 |
| Q |
217 |
atactcaaatgtaatccaacatctttactatgtttttactttgcatggtggtgtatcattgcacccnnnnnnncttatgtaatcacttattaaaatgaaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
30599087 |
atactcaaatgtaatccaacatctttactatgtttttactttgcatggtggtgtatcattgcgccc-aaaaaacttatgtaatcacttattaaaatgaaa |
30598989 |
T |
 |
| Q |
317 |
cagctttatccatcattgtattcttcttttttccttttatttgttcatct |
366 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30598988 |
cagctttatccatcattgtatttttcttttttccttttatttgttcatct |
30598939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 366
Target Start/End: Complemental strand, 2411352 - 2411214
Alignment:
| Q |
223 |
aaatgtaatccaacatctttactatgtttttactttgcatggtggtgtatcattgcacccnnnnnnncttatgtaatcacttattaaaatgaaacagctt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | ||||||| |||||| |||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
2411352 |
aaatgtaatccaacatctttactatgtttt-acactacatggtg---tatcatagcacccaaaaaa-cttatgtaatcacttattaaaatgaaatagctt |
2411258 |
T |
 |
| Q |
323 |
tatccatcattgtattcttcttttttccttttatttgttcatct |
366 |
Q |
| |
|
||||||| ||| |||| ||||| ||| |||| ||||||||||| |
|
|
| T |
2411257 |
catccatctttgcattcgtctttattctttttctttgttcatct |
2411214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 2411416 - 2411380
Alignment:
| Q |
184 |
tatgaagggagcagtgttcattttcagtctttgatac |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2411416 |
tatgaagggagcagtgttctttttcagtctttgatac |
2411380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 366
Target Start/End: Complemental strand, 13668 - 13595
Alignment:
| Q |
293 |
atgtaatcacttattaaaatgaaacagctttatccatcattgtattcttcttttttccttttatttgttcatct |
366 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| ||| ||| || |||| | ||| ||||||||||| |
|
|
| T |
13668 |
atgtaatcacttattaaaatgaaacaacttcatccatctttgcattttttttttcttttttcttttgttcatct |
13595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University