View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_high_12 (Length: 367)
Name: NF10468_high_12
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 334
Target Start/End: Original strand, 10156452 - 10156763
Alignment:
| Q |
19 |
aggaggtatggaattgaacattggaaattaacataacactaactcactgaccaatattagcttataaaaatggtaaatagaatagacaaaaagcctcaac |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
10156452 |
aggaggtatggaattgaaccatggaaattaacataacactgactcaccaatcaatattagcttataaaaatggtaaatagaataaa-aaaaagcctcaac |
10156550 |
T |
 |
| Q |
119 |
caaatttctttattcaaagacattttgaaaacaaaatgcaacaaattttaacttcaagtaatgacataaaatataaaaatctcaaaacatcccgaagatg |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||| ||| |
|
|
| T |
10156551 |
catatttctttattcaaagacattttgaaaacaaaatgcaacaaattttaacttcaagtaatgacagaatat---aaaatctcaaaacatcccgaatatg |
10156647 |
T |
 |
| Q |
219 |
tcgtccacaaggcaacatcaccggcctgggtttgcaatcaagctgcagggg-aaaatcccgcaagcccaaacccgtggaaaagggcccaagctcggggtt |
317 |
Q |
| |
|
||| |||||||||||||||| | | |||||||||| ||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
10156648 |
tcgcccacaaggcaacatca-ctgtctgggtttgcgatcaagctgcaggggaaaaaacccgcaagcccaaacctgtggaaaagggcccaagctcggggct |
10156746 |
T |
 |
| Q |
318 |
gttaccacataatattg |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10156747 |
gttaccacataatattg |
10156763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University