View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_high_18 (Length: 324)
Name: NF10468_high_18
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 25 - 305
Target Start/End: Complemental strand, 16796527 - 16796246
Alignment:
| Q |
25 |
caaaagaggggtatagtatggcaaatacttacggacaatatgtcttggaaaagatggcgatcttgttgttgttaatggtcttgtcaacaaactcaccaac |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16796527 |
caaaagaggggtatagtatggtaaatacttacggacaatatgtcttggaaaagatggcgatcttgttgttattaatggtcttgtcaacaaactcaccaac |
16796428 |
T |
|
| Q |
125 |
agaagaagctgctgaagctgaatccaaataaacagaaattgctaaaaccatcatcaccatcatcattgttaccttcattctcgctgatttaactgtcaag |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16796427 |
agaagaagctgctgaagctgaatccaaataaacagaaattgctaaaaccatcatcaccatcatcattgttaccttcattctcgctgatttaactgtcaac |
16796328 |
T |
|
| Q |
225 |
aaacatcataaaatgaaacgaataaaacaac-aaggagtgtctttaacaaaaatggaagagacatgcttacagggctgatct |
305 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16796327 |
aaacatcataaaatgaaaccaataaaacaacaaaggagtgtctttaacaaaaatggaagagacatgcttacagggctgatct |
16796246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University