View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_high_2 (Length: 461)
Name: NF10468_high_2
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 144 - 396
Target Start/End: Complemental strand, 41899032 - 41898780
Alignment:
| Q |
144 |
gaactcaaaataatttgcaaaagaaccaaatttgctttttatataacccccttcaaccaattggaattctttcctttctcttggggttttcttcttctct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41899032 |
gaactcaaaataatttgcaaaagaaccaaatttgctttttatataacccccttcaaccaattggaattctttcctttctcttggggttttcttcttctct |
41898933 |
T |
|
| Q |
244 |
caatttaccaccacttttgccacttgcatgttgctttataacctttttatcttatcatgtactaggttttaagctttagtttggtagcatttgaattatg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41898932 |
caatttaccaccacttttgccacttgcatgttgctttataacctttttatcttatcatgtactaggttttaagctttagtttggtagcatttgaattatg |
41898833 |
T |
|
| Q |
344 |
tgtatgcgaaagttgaattatcgagtgggctacttgcttttatgaaatacttt |
396 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41898832 |
tctatgcgaaagttgaattatcgagtgggctacttgcttttatgaaatacttt |
41898780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 41899174 - 41899059
Alignment:
| Q |
1 |
atctcaattctagagaggattagttagatataatgttattactacgataaaacaagaagaaagaaaattcgactcgactcatttccagacctacttatgt |
100 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41899174 |
atctcaatactagagatgattagttagatataatgttattactacgataaaataagaagaaagaaaattcgactcgactcatttccagacctacttatgt |
41899075 |
T |
|
| Q |
101 |
cttttgtctagatcac |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41899074 |
cttttgtctagatcac |
41899059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 68 - 96
Target Start/End: Original strand, 4442110 - 4442138
Alignment:
| Q |
68 |
ttcgactcgactcatttccagacctactt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4442110 |
ttcgactcgactcatttccagacctactt |
4442138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University