View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_high_21 (Length: 316)
Name: NF10468_high_21
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 274
Target Start/End: Complemental strand, 48319645 - 48319381
Alignment:
| Q |
13 |
cctctacctcttcctcttctacttccacctcccatttttgcttccaataatcgtgaatggagcgagctttgattttgtgtttcaatggcggtgaagattg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48319645 |
cctctacctcttcctcttctacttccacctcccatttttgcttccaataatcgtgaatggagcgagctttgattttgcgtttcaatggcggtgaagattg |
48319546 |
T |
 |
| Q |
113 |
gaacacgaaagtgggaccc-acgtgttgatttctacccgctatacgggtctgacccgataggatattccccattcgatccgaatcaacaatatatccatg |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48319545 |
gaacacgaaagtgggaccccacgtgttgatttctacccgctatacgggtctgacccgataggatattccccatccgatccgaatcaacaatatatccatg |
48319446 |
T |
 |
| Q |
212 |
gttgggtccaatttttggcccaataaattaacaaa--atatgttttgccccctatctttttagta |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48319445 |
gttgggtccaatttttggcccaataaattaacaaaatatatgttttgccccctatctttttagta |
48319381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University