View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_high_41 (Length: 239)
Name: NF10468_high_41
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 43159930 - 43160153
Alignment:
| Q |
1 |
gaactagctcaaggccatttcatggtaatcaaaaccttggaggaaaatgtttctcttgctacagttataaaggtaggagaagatcttcaatggcctttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43159930 |
gaactagctcaaggccatttcatggtaatcaaaaccttggaggaaaatgtttctcttgctacagttataaaggtagaagaagatcttcaatggcctttaa |
43160029 |
T |
 |
| Q |
101 |
ctaaagatgagcctgtggtgaagctagatgctctccattacctgttttcgttgcccgtgaaagatggcgagcctcttagctacggcttgaccttttcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43160030 |
ctaaagatgagcctgtggtgaagctagatgctctccattacctgttttcgttgcccgtgaaagatggcgagcctcttagctacggcttgaccttttcaga |
43160129 |
T |
 |
| Q |
201 |
agatagttatggaagcttgagttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43160130 |
agatagttatggaagcttgagttt |
43160153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 23822193 - 23822333
Alignment:
| Q |
1 |
gaactagctcaaggccatttcatggtaatcaaaaccttggaggaaaatgtttctcttgctacagttataaaggtaggagaagatcttcaatggcctttaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23822193 |
gaactagctcaatgccatttcatggtcatcaaaaccttggaggaatatgtgtctcttgctacagttataaaagtaggagaagatcttcaatggcctttaa |
23822292 |
T |
 |
| Q |
101 |
ctaaagatgagcctgtggtgaagctagatgctctccattac |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23822293 |
ctaaagatgagcctgtggtgaagctagatgctctccattac |
23822333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 40171434 - 40171294
Alignment:
| Q |
1 |
gaactagctcaaggccatttcatggtaatcaaaaccttggaggaaaatgtttctcttgctacagttataaaggtaggagaagatcttcaatggcctttaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40171434 |
gaactagctcaatgccatttcatggtcatcaaaaccttggaggaatatgtgtctcttgctacagttataaaagtaggagaagatcttcaatggcctttaa |
40171335 |
T |
 |
| Q |
101 |
ctaaagatgagcctgtggtgaagctagatgctctccattac |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40171334 |
ctaaagatgagcctgtggtgaagctagatgctctccattac |
40171294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University