View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_high_45 (Length: 231)
Name: NF10468_high_45
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 212
Target Start/End: Complemental strand, 53426498 - 53426294
Alignment:
| Q |
8 |
agagagaagaactaaatgatgcataaacagaatgctcttatgggtgtggtctgagagaaagtgcttcaatattttcttcgagtgcaacttaaacatggag |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53426498 |
agagagaagtactaaatgatgcataaacagaatgctcttatgggtgtggtctgagagaaagtgcttcaatattttcttcgagtgcaacttaaacatggag |
53426399 |
T |
|
| Q |
108 |
atctgatataagattctgcgttggttgaacgtatctggagcgcttcacaattctgcattatcaaacatccatcggttcaaaggattgtgcgaaacaggca |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53426398 |
atctgatataagattctgagttggttgaacgtatctggagcgcttcacaattctgcattatcaaacatccatcggttcaaaggattgtgtgaaacaggca |
53426299 |
T |
|
| Q |
208 |
cagtt |
212 |
Q |
| |
|
||||| |
|
|
| T |
53426298 |
cagtt |
53426294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University