View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_low_22 (Length: 336)
Name: NF10468_low_22
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 57 - 318
Target Start/End: Complemental strand, 15631128 - 15630867
Alignment:
| Q |
57 |
ctcagagtcatgaacatagctttggcaaagatttaccataactataaccagatgcttttgattttgtcatcttagccatctgagtttgcattttcttaca |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15631128 |
ctcagagtcatgaacatagctttggcaaagatttaccataactatgaccagatgcttttgattttgtcatcttagccatctgagtttgcattttcttaca |
15631029 |
T |
|
| Q |
157 |
tactttctctaattccataactctccactgcattccttgcaaatgttctttcattttctcattagcaggttgaatatcaaaatttccagcatacaacaca |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15631028 |
tactttctctaattccataactctccactgcattccttgcaaatgttctttcattttctcattatcaggttgaatatcaaaatttccagcatacaacaca |
15630929 |
T |
|
| Q |
257 |
acttgttcattgcttttttctttctttcccttttgagatgaaccacttgaaccacacaaaga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15630928 |
acttgttcattgcttttttctttctttcccttttgagatgaaccacttgaaccacacaaaga |
15630867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University