View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_low_40 (Length: 248)
Name: NF10468_low_40
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_low_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 21851335 - 21851103
Alignment:
| Q |
13 |
atggacatcattcgatatgaccctgctaactttagtttagaggacatgatttcttggaagaccaagatcctgtcctgcacaattatttcaccattttgaa |
112 |
Q |
| |
|
||||||| || ||||||||||| ||| ||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21851335 |
atggacaacaatcgatatgaccatgcgaactttagtttagaggacaggattgcttggaagaccaagatcttgtcctgcacaattatttcaccattttgaa |
21851236 |
T |
 |
| Q |
113 |
ttctgaacctgacacggtgcaaggagaggctttggttgatgatatgaaagatattgatggctcttttaacaagcttttagctgatattgagccactcaat |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21851235 |
ttctgaacctgacagggtgcaaggagaggctttggt---tgatatgaaagatattgatggctcttttaacaagcttttagctgatattgagccactcaat |
21851139 |
T |
 |
| Q |
213 |
gctcattatggtgaagaagtttctttgattcataac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21851138 |
gctcattatggtgaagaagtttctttgattcataac |
21851103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University