View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_low_47 (Length: 241)
Name: NF10468_low_47
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 21851082 - 21850858
Alignment:
| Q |
1 |
ttctaaggaaataatccccatcaaacttgtgtctcatgatacctcagatcttacgaagtcttctgacattgggaggatgtcattccccaattcagcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21851082 |
ttctaaggaaataatccccatcaaacttgtgtctcatgatacctcagatcttacgaagtcttctgacattgggatgatgtcattccccaattcagcttca |
21850983 |
T |
|
| Q |
101 |
acttcacttggttagggtggcatacctgggaggcggtcatttcccaagatcacttatgtttcatgagacaaatctagggacccttatatcactcctatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21850982 |
acttcacttggttagggtggcatacctgggaggcggtcattccccaagatcacttatgtttcatgagacaaatctagggacccttatatcactcctatga |
21850883 |
T |
|
| Q |
201 |
cacaacctgcaaaccaccatgtttg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
21850882 |
cacaacctgcaaaccaccatgtttg |
21850858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 102
Target Start/End: Complemental strand, 22970561 - 22970514
Alignment:
| Q |
55 |
gaagtcttctgacattgggaggatgtcattccccaattcagcttcaac |
102 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||| |||||||||||| |
|
|
| T |
22970561 |
gaagttttctgacactgggagggtgtcattccccagttcagcttcaac |
22970514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University