View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10468_low_54 (Length: 239)
Name: NF10468_low_54
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10468_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 51406357 - 51406580
Alignment:
| Q |
1 |
gaccaccacggacttcgacggacgggcatactaatcatctggactgccctgccttgcaaacatgacttggacactcactgaagtaagaattgcggtacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
51406357 |
gaccaccacggacttcgacggacgggcatactaatcatctggactgccctgccttgcaaacatgacttggacactcactgaagtaag-atcgcggtacac |
51406455 |
T |
|
| Q |
101 |
ctgctcttttgttaccttctccggccatatcctgttg-aaaattatgatgttgttgatgcacaccaacatctcatatttgtaagggattaaattgcggta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51406456 |
ctgctcttttgttaccttctccggccatatcctgttgaaaaattatgatgttgttgatgcacaccaacatctcatatttgtaagggattaaattgcggta |
51406555 |
T |
|
| Q |
200 |
tttaactgttccatgcgttctgctt |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
51406556 |
tttaactgttccatgcgttctgctt |
51406580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University