View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10469_low_6 (Length: 258)
Name: NF10469_low_6
Description: NF10469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10469_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 3 - 249
Target Start/End: Complemental strand, 11454736 - 11454490
Alignment:
| Q |
3 |
ctatttagtgtgtttgcttagtcaatcagctgacaaaaattgaatattagtattattgtttttagataggtacttcttcaatagaatattagatcatgat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11454736 |
ctatttagtgtgtttgcttagtcaatcagctgacaaaaatagaatattagtattattgtttttagataggtacttcttcaatagaatattagatcatgat |
11454637 |
T |
|
| Q |
103 |
tgagtcgtgattaatcagttgactttattgatgaaaagtagttatctacattatgttatatgcatgcacaattgatagtttgagttaatatgattgatat |
202 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11454636 |
tgagtcgtgattaatcggttgactttattgatgaaaagtagttatctacattatgttatatgcatgcacaattgatagtttgagttaatataattgatat |
11454537 |
T |
|
| Q |
203 |
ttgattttctagtttaattattaagagaaatctacattcttctctct |
249 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11454536 |
tggattttctagtttaattattaagagaaatttacattcttctctct |
11454490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University