View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_high_10 (Length: 309)
Name: NF10470_high_10
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 140 - 291
Target Start/End: Original strand, 6856136 - 6856287
Alignment:
| Q |
140 |
ctatgtctagtacgtggctttatatgtaatcgaacttggttttggaatatggtttctgaatataccatatgacttggtttacaaacagaatggaagcttc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6856136 |
ctatgtctagtacgtggctttatatgtaatggaacttggttttggaatatggtttctgaatataccatatgacttggtttacaaacagaatggaagcttc |
6856235 |
T |
 |
| Q |
240 |
ttgtaactttgattatttaaggtttgaataattgaaccttcctccctctact |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6856236 |
ttgtaactttgattatttaaggtttgaataattgaaccttcctccctctact |
6856287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 3 - 93
Target Start/End: Original strand, 6855999 - 6856089
Alignment:
| Q |
3 |
agtacatagatatagatagatataacaataaagaaaagaatctatggatttaggtgagaatttatcaatagccacacaaataaaattgtct |
93 |
Q |
| |
|
||||||||||||||||||||| | ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6855999 |
agtacatagatatagatagatgtggcaaaaaagaaaagaatctatggatttagttgagaatttatcaatagccacacaaatgaaattgtct |
6856089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University