View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_high_20 (Length: 238)
Name: NF10470_high_20
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 114 - 222
Target Start/End: Original strand, 4877690 - 4877798
Alignment:
| Q |
114 |
gattacatgctttctagtttgttaaataaggcaaatatgtccttcaaattaacagatacctatgtttcttcttttatgctttttgattaagcttttgatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4877690 |
gattacatgctttctagtttgttaaataaggcaaatatgtccttcaaattaacagatacctatgtttcttcttttatgctttttgattaagcttttgatt |
4877789 |
T |
 |
| Q |
214 |
atgcctatg |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
4877790 |
atgcctatg |
4877798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 24 - 77
Target Start/End: Original strand, 4877648 - 4877702
Alignment:
| Q |
24 |
ggaacttgtttgttcgcggatt-gattgctagaggtctattagattacatgcttt |
77 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4877648 |
ggaacttgtttgttcgcggatttgattgctagaggtctattagattacatgcttt |
4877702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 670484 - 670434
Alignment:
| Q |
51 |
ctagaggtctattagattacatgctttttggtttgctaattaaagaactat |
101 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
670484 |
ctagaggtctattagattacatgctttccagttttctaattaaagaactat |
670434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 2288395 - 2288345
Alignment:
| Q |
169 |
atacctatgtttcttcttttatgctttttgattaagcttttgattatgcctat |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2288395 |
atacctatgtttcttgatttatgctttttgattaagc--ttgattatgcctat |
2288345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 28326870 - 28326916
Alignment:
| Q |
62 |
ttagattacatgctttttg-gtttgctaattaaagaactatgctttt |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
28326870 |
ttagattacatgcttttttagtttgctaattaaaggactatgctttt |
28326916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 29 - 107
Target Start/End: Complemental strand, 47923090 - 47923009
Alignment:
| Q |
29 |
ttgtttgttcgcggattgattgctagaggtctatta---gattacatgctttttggtttgctaattaaagaactatgctttt |
107 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||| ||||| |||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
47923090 |
ttgttcgttcgtgggttgattgctagaggtctattatcagattatatgcttattggtttgctaatcaaagaactatgatttt |
47923009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 107
Target Start/End: Original strand, 9066862 - 9066898
Alignment:
| Q |
71 |
atgctttttggtttgctaattaaagaactatgctttt |
107 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
9066862 |
atgctttttggtttgctaattgaaggactatgctttt |
9066898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University