View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_high_21 (Length: 238)
Name: NF10470_high_21
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 26 - 136
Target Start/End: Complemental strand, 36925830 - 36925720
Alignment:
| Q |
26 |
acagtttgcaacactaaaaaagaatttgtaaataaagtcagaaaagattattagttttggcatgattttgaatcgtatactgcattataggatgtatgtt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36925830 |
acagtttgcaacactaaaaaagaatttgtaaataaagtcagaaaagattattagtttcggcatgattttgaatcgtatactgcattataggatgtatgtt |
36925731 |
T |
 |
| Q |
126 |
gatagtatttg |
136 |
Q |
| |
|
||||||||||| |
|
|
| T |
36925730 |
gatagtatttg |
36925720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 36925690 - 36925625
Alignment:
| Q |
158 |
ctaacttggtttcctgtgtacgatatcaattagtcactacttactatccaattctttcggtgttat |
223 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
36925690 |
ctaacttggtctcctgtgtacgatatcaattagtcattactttctatccaattctttcggtgttat |
36925625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 5 - 110
Target Start/End: Complemental strand, 50435680 - 50435576
Alignment:
| Q |
5 |
gatgcaaggaagacagttactacagtttgcaacactaaaaaagaatttgtaaataaagtcagaaaagattattagttttggcatgattttgaatcgtata |
104 |
Q |
| |
|
|||||||||||| ||||| |||| |||||| ||| |||||||| |||||||||||||||||||||| |||||||| | ||||| |||||||| ||||| |
|
|
| T |
50435680 |
gatgcaaggaagggagttattacaatttgca-caccaaaaaagattttgtaaataaagtcagaaaaggttattagtctcagcatggttttgaattgtata |
50435582 |
T |
 |
| Q |
105 |
ctgcat |
110 |
Q |
| |
|
|||||| |
|
|
| T |
50435581 |
ctgcat |
50435576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University