View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10470_high_23 (Length: 206)

Name: NF10470_high_23
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10470_high_23
NF10470_high_23
[»] chr3 (1 HSPs)
chr3 (97-206)||(41750262-41750371)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 97 - 206
Target Start/End: Original strand, 41750262 - 41750371
Alignment:
97 tttggattcattcaattgcaattatagaaggggtctgcatcatttgcatcttaatcgtatgaattttttcaatttacgcacaattacttactcattcatt 196  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41750262 tttgggttcattcaattgcaattatagaaggggtctgcatcatttgcatcttaatcgtatgaattttttcaatttacgcacaattacttactcattcatt 41750361  T
197 agtagcttcc 206  Q
    ||||||||||    
41750362 agtagcttcc 41750371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University