View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_high_23 (Length: 206)
Name: NF10470_high_23
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_high_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 97 - 206
Target Start/End: Original strand, 41750262 - 41750371
Alignment:
| Q |
97 |
tttggattcattcaattgcaattatagaaggggtctgcatcatttgcatcttaatcgtatgaattttttcaatttacgcacaattacttactcattcatt |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41750262 |
tttgggttcattcaattgcaattatagaaggggtctgcatcatttgcatcttaatcgtatgaattttttcaatttacgcacaattacttactcattcatt |
41750361 |
T |
 |
| Q |
197 |
agtagcttcc |
206 |
Q |
| |
|
|||||||||| |
|
|
| T |
41750362 |
agtagcttcc |
41750371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University