View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_high_6 (Length: 395)
Name: NF10470_high_6
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 395
Target Start/End: Complemental strand, 26568133 - 26567739
Alignment:
| Q |
1 |
tattgaactcgtgtccggtgtctgagtctgacacgtgttaatgtctaaaacttacacttgtgactgcatttaattattcgatttttcaaaattttaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568133 |
tattgaactcgtgtccggtgtctgagtctgacacgtgttaatgtctaaaacttacacttgtgactgcatttaattattcgatttttcaaaattttaaccg |
26568034 |
T |
 |
| Q |
101 |
ctatcaatatctcagtgccgtgtgtctagtgtttatgtttgtatccaactaagaggataaagtagaaatgaacctgagatatcttagggaggtcagaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568033 |
ctatcaatatctcagtgccgtgtgtctagtgtttatgtttgtatccaactaagaggataaagtagaaatgaacctgagatatcttagggaggtcagaaag |
26567934 |
T |
 |
| Q |
201 |
atttctgtcctttgcaatggctcggatcaaatcgcttttttattgtaaatactccctgcacattgtctactcaaattcatcagttttagcacaatgtggc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26567933 |
atttctgtcctttgcaatggctcggatcaaatctcttttttcttgtacatactccctgcacattgtctactcaaattcatcagttttagcacaatgtggc |
26567834 |
T |
 |
| Q |
301 |
ctctttattttgaacacaatagtttagttattaaaagttgcagctgaaacatatcatattcaaacataacatagacacaaaacattctttttaac |
395 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
26567833 |
ctctttattttcaacaccatagtttagttattaaaagttgcagctgaaacatatcttattcaaccataacatagacacaacacattctttttaac |
26567739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University