View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_15 (Length: 316)
Name: NF10470_low_15
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 16 - 308
Target Start/End: Complemental strand, 40384385 - 40384093
Alignment:
| Q |
16 |
atgaagaacccgaaattacaaaaccaaacggcaccaagattctcctcaatgatatctccggtgaagcaagagacggtgaaatcatggcagttcttggtgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384385 |
atgaagaacccgaaattacaaaaccaaacggcaccaagattctcctcaatgatatctccggtgaagcaagagacggtgaaatcatggcagttcttggtgc |
40384286 |
T |
 |
| Q |
116 |
aagtggctccggcaagtcaactctcatcgacgctctcgctgacagaatttccaaagagtctctcaaaggcactgtaactctaaacggtgacgttttggag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384285 |
aagtggctccggcaagtcaactctcatcgacgctctcgctgacagaatttccaaagagtctctcaaaggcactgtaactctaaacggtgacgttttggag |
40384186 |
T |
 |
| Q |
216 |
tcaagtcttcaaaaggttatatcagcttatgtcatgcaagacgatcttctcttccccatgctcaccgtggaagaaactctcatgttctctgct |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384185 |
tcaagtcttcaaaaggttatatcagcttatgtcatgcaagacgatcttctcttccccatgctcaccgtggaagaaactctcatgttctctgct |
40384093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 52374803 - 52374855
Alignment:
| Q |
51 |
aagattctcctcaatgatatctccggtgaagcaagagacggtgaaatcatggc |
103 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||| | |||||||| |||||||| |
|
|
| T |
52374803 |
aagattctgctcaacgaaatctccggtgaagcacgtgacggtgagatcatggc |
52374855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University