View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_26 (Length: 250)
Name: NF10470_low_26
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 36925918 - 36926156
Alignment:
| Q |
1 |
ctttttaaaatttaggtgctatatagtggtttcaatgtagaaacctaagtgcagctcaaacccaaattcttttgtgtgacatttgtcgtagaaatgactt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
36925918 |
ctttttaaaatttaggtgctata--gtggtttcaatgtagaaacctaattgcagctcaaacccaaattcttttgtgtgactt-----gtagaaatgactt |
36926010 |
T |
|
| Q |
101 |
tgaagattgacacgcaatacatggatgatcagctgaggaatgctaatgagaattttggtttggactgggtagggtttagcaatttgaaaatactttattt |
200 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36926011 |
tgaagattggcacgcaatacctggatgaccagctgaggaatgctaatgagaaccttggtttggactgggtagggtttagcaatttgaaaatattttattt |
36926110 |
T |
|
| Q |
201 |
gctctggcatcgtccacgttgcagacttcaaacattcttctctctc |
246 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |||||||| |
|
|
| T |
36926111 |
gctctggcgtcatccacgttgcagacttcaaacattcatctctctc |
36926156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University