View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_27 (Length: 250)
Name: NF10470_low_27
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 56468688 - 56468542
Alignment:
| Q |
1 |
ccgcaagtaagcagtaactttggggactcactatcaaccaaccacatactcatctatagtct-ataatacaaagtacaaaaaacatgttctatctctaca |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56468688 |
ccgcaagtaagcagtgactttggggactcaccatcaaccaaccacatactcatctatagtcttataatacaaagtacaaaaaacatgttctatctctaca |
56468589 |
T |
 |
| Q |
100 |
gtactaaattatctttactagaaagaaccaccttgttgttctaggat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56468588 |
gtactaaattatctttactagaaagaaccaccttgttgttctaggat |
56468542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 175 - 242
Target Start/End: Complemental strand, 56468523 - 56468456
Alignment:
| Q |
175 |
gcacaatatatacctgaaattggaagcacctcatattaattttcatatattttgttttgtttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56468523 |
gcacaatatatacctgaaattggaagcacctcatattaattttcatatattttgttttgtttcatctc |
56468456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University