View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_31 (Length: 237)
Name: NF10470_low_31
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_31 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 39087409 - 39087636
Alignment:
| Q |
16 |
ttaccaaggcagaagactagatatattacaaannnnnnnngggtatgcaacactccaattagtagtacaaacagacat-------ttttctagtttgtat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
39087409 |
ttaccaaggcagaagactagatatattacaa-ttttttttgggtatgcaacactccaattagtagtacaaacaaacaaacaaacattttctagtttgtat |
39087507 |
T |
|
| Q |
109 |
attttcttaatagatcttcattggatcctctctcaagttgtccatcttcgctgagtctatgcttgctcttagatttggcatcgtgtctagaagggtgtcc |
208 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39087508 |
attttctcaatagatcttcattggattctctctcaagttgtccatcttcgctgagtctatgcttgctcttagatttggcatcgtgtctggaagggtgtcc |
39087607 |
T |
|
| Q |
209 |
ttcattcgagtttagattcttcgatttgg |
237 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
39087608 |
ttcgttcgagtttagattcttcgatttgg |
39087636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University