View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_32 (Length: 227)
Name: NF10470_low_32
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_32 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 74 - 227
Target Start/End: Original strand, 40573562 - 40573715
Alignment:
| Q |
74 |
ccccctcaactggtccatggtgaccataataatgtggttttttggtgtgtagcttctcagcagcatgccttgctttagcttcatgtagctccatctttgc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40573562 |
ccccctcaactggtccatggtgaccataataatgtggttttttggtgtgtagcttctcagcagcatgccttgctttagcttcatgtagctccatctttgc |
40573661 |
T |
|
| Q |
174 |
tttatgttctttagctttagcacgctcatgtgctatcactttctcctcttttgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40573662 |
tttatgttctttagctttagcacgctcatgtgctatcactttctcctcttttgt |
40573715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 40573459 - 40573531
Alignment:
| Q |
1 |
actggttcattttcttggtactgatttcctaccactgcttgtggctgatgaaccccaactggttcattttttg |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40573459 |
actggttcattttcttggtactgatttcctaccactgcttctggctgatgaaccccaactggttcattttttg |
40573531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University