View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_33 (Length: 217)
Name: NF10470_low_33
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 28226342 - 28226157
Alignment:
| Q |
18 |
catctgctcttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatggaaaaagggcatgtgaaattcacctcaagatagatatcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226342 |
catctgctcttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatggaaaaagggcatgtgaaattcacctcaagatagatatcaat |
28226243 |
T |
|
| Q |
118 |
ggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatctttaggttct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226242 |
ggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatctttaggttct |
28226157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 94 - 203
Target Start/End: Original strand, 13040378 - 13040487
Alignment:
| Q |
94 |
attcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatc |
193 |
Q |
| |
|
|||||||||||| ||||| ||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||| ||||| | || |||||||||||| |
|
|
| T |
13040378 |
attcacctcaaggtagatgtcaatggctctatagaccccatcaaagcaatcccttgcaaaatcaggcaaacattctacaacttctaggaatttagagatc |
13040477 |
T |
|
| Q |
194 |
tttaggttct |
203 |
Q |
| |
|
| ||||||| |
|
|
| T |
13040478 |
tcaaggttct |
13040487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University