View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_35 (Length: 208)
Name: NF10470_low_35
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 40313288 - 40313104
Alignment:
| Q |
19 |
gtagggcagatatgtgaaattgatattaatttaaggaacatgtgttgttgccgaatccatatggattaagaagcttttgtcgttggtcttctacgtccca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40313288 |
gtagggcagatatgtgaaattgatattaatttaaggaacatgtgttgttgccgaatccatatggattaagaagcttttgtcgttggtcttctacgtccca |
40313189 |
T |
|
| Q |
119 |
aaatgatccatcagtgtgctgaaaatgatatatgcttttcatcataataaggaaatggtgaaagtactttttgtttcttctctct |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
40313188 |
aaatggtccatcagtgtgctgaaaatgatatatgcttttcatcataataaggaaatggtgaaagtactatttgtttcttttctct |
40313104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University