View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10470_low_37 (Length: 202)
Name: NF10470_low_37
Description: NF10470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10470_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 10348450 - 10348633
Alignment:
| Q |
1 |
cgataagagacattttactgttacggaggaggtcggtggggctccgcgtggaaggatcgatgttggtggtgaagggatggttgagtggaatgatagattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
10348450 |
cgataagagacattttactgttacggaggaggtcggtggggctccgcgtggaaggatcgatgttggtagtgaagggatagttgagtggaatgatagattt |
10348549 |
T |
|
| Q |
101 |
ggttaggtaagggaaatggagttggtagaaatcggtggtgttgtgacggaggatgaggttgaaatttagagaattttttaggtg |
184 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10348550 |
ggttaggttagggaaatggagttggtagaaatcggtggtgttgtgacggaggatgaggttgaaatttagagaattttttaggtg |
10348633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 46 - 184
Target Start/End: Complemental strand, 9283628 - 9283493
Alignment:
| Q |
46 |
gcgtggaaggatcgatgttggtggtgaagggatggttgagtggaatgatagatttggttaggtaagggaaatggagttggtagaaatcggtggtgttgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| || || || ||||||||||||| |||||||| ||||||||||| || |||| ||||| |
|
|
| T |
9283628 |
gcgtgaaaggatcgatgttggtggtgaaaggatggttgagcggtattatggatttggttaggttagggaaatcgagttggtagagat---tggtcttgtg |
9283532 |
T |
|
| Q |
146 |
acggaggatgaggttgaaatttagagaattttttaggtg |
184 |
Q |
| |
|
|||||||||||| ||||| || || ||| |||| ||||| |
|
|
| T |
9283531 |
acggaggatgagtttgaagttgagggaacttttgaggtg |
9283493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 101 - 166
Target Start/End: Complemental strand, 7115047 - 7114982
Alignment:
| Q |
101 |
ggttaggtaagggaaatggagttggtagaaatcggtggtgttgtgacggaggatgaggttgaaatt |
166 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| || | |||||||||||||||| ||||||||| |
|
|
| T |
7115047 |
ggttaggttagggaaatggagttggtagagatcgttgttcttgtgacggaggatgaagttgaaatt |
7114982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 163
Target Start/End: Complemental strand, 11986925 - 11986865
Alignment:
| Q |
100 |
tggttaggtaagggaaatggagttggtagaaatcggtggtgttgtgacggaggatgaggttgaa |
163 |
Q |
| |
|
||||||||| ||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
11986925 |
tggttaggttagggaaatggagttgatagagat---tggtgttgtgacggaggatgaggttgaa |
11986865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 60 - 136
Target Start/End: Original strand, 9329305 - 9329381
Alignment:
| Q |
60 |
atgttggtggtgaagggatggttgagtggaatgatagatttggttaggtaagggaaatggagttggtagaaatcggt |
136 |
Q |
| |
|
||||||||| |||| ||||||||||||||||| || ||||||||||| | ||| | || ||||||||||| |||||| |
|
|
| T |
9329305 |
atgttggtgctgaaaggatggttgagtggaatcatggatttggttagattaggaagatcgagttggtagagatcggt |
9329381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 166
Target Start/End: Complemental strand, 12018345 - 12018254
Alignment:
| Q |
69 |
gtgaagggatggttgagtggaatgatagatttggttaggtaagggaaatggagttggtagaaatcggtggtgttgtgacggaggatgaggttgaaatt |
166 |
Q |
| |
|
||||| |||||||||||||| |||| | |||||||| |||||||||||||||||||| || |||| | |||||||||||||||||||||||| |
|
|
| T |
12018345 |
gtgaaaggatggttgagtgggatgacgg---tggttagggtagggaaatggagttggtagagatgggtg---tcgtgacggaggatgaggttgaaatt |
12018254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University