View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10471_high_7 (Length: 251)
Name: NF10471_high_7
Description: NF10471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10471_high_7 |
 | |
|
| [»] scaffold0373 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 97 - 241
Target Start/End: Complemental strand, 6829750 - 6829606
Alignment:
| Q |
97 |
caagtcaaagtcgtcttataaactatagctattgcacttgcaacgaacattactagtcactctactttgatcagtttttggtannnnnnnnnnnnnnnng |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6829750 |
caagtcaaagtcgtcttataaactatagctattgcacttgcaacgaacattactagtcactctactttgatcagtttttggtattttttatttttttttg |
6829651 |
T |
|
| Q |
197 |
gtttagatacctgcactttgttaaaaaattgttattgatcctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6829650 |
gtttagatacctgcactttgttaaaaaattgttattgatcctttg |
6829606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 6829819 - 6829736
Alignment:
| Q |
1 |
ctgaagttgcaagtgaaatgatgaagctgtatgaattgcttacttttgtgagtattactgttactatttcaagtcaaagtcgtc |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6829819 |
ctgaagttgcaagtgaaatgatgaagctgtatgaattgcttacttttgtgagtattactgttactatttcaagtcaaagtcgtc |
6829736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 97 - 241
Target Start/End: Original strand, 6669 - 6814
Alignment:
| Q |
97 |
caagtcaaagtcgtcttataaactatagctattgcacttgcaacgaacattactagtcactctactttgatcagtttttggta-nnnnnnnnnnnnnnnn |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6669 |
caagtcaaagtcgtcttataaactatagctattgcacttgcaacgaacattactagtcactctactttgatcagtttttggtattttttatttttttttt |
6768 |
T |
|
| Q |
196 |
ggtttagatacctgcactttgttaaaaaattgttattgatcctttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6769 |
ggtttagatacctgcactttgttaaaaaattgttattgatcctttg |
6814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University