View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10471_low_1 (Length: 464)
Name: NF10471_low_1
Description: NF10471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10471_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 20 - 271
Target Start/End: Original strand, 6945972 - 6946223
Alignment:
| Q |
20 |
tgaggtttggtgggtcaggtgatctgtggagtttaatcctttggtgaaatagttgattgttggtcaatcttctgggatgtagttcatggtgccttttctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945972 |
tgaggtttggtgggtcaggtgatctgtggagtttaatcctttggtgaaatagttgattgttggtcaatcttctgggatgtagttcatggtgccttttctc |
6946071 |
T |
|
| Q |
120 |
tggcttgataggagttgtagagatgttacaattttggaaaggctcttggttggatctttggtgttggtgaagtataattctgaggtatgttaattgcatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6946072 |
tggcttgataggagttgtagagatgttacaattttgaaaaggctcttggttggatctttggtgttggtgaagtataattctgaggtatgttaattgcatt |
6946171 |
T |
|
| Q |
220 |
gttgagtcgtcttggttgtatctcaatatccttgtcatgttggctgcgaaat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6946172 |
gttgagtcgtcttggttgtatctcaatatccttatcatgttggctgcgaaat |
6946223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University