View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10471_low_14 (Length: 238)
Name: NF10471_low_14
Description: NF10471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10471_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 23145060 - 23144965
Alignment:
| Q |
128 |
agaaaataaattatgacttacaaaagtgcatatatacggctgaaatcttaaaacgaaaacttctatctcagacaacatcggatgcaatgtaatagg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23145060 |
agaaaataaattatgacttacaaaagtgcatatatacggctgaaatcttaaaatgaaaacttctatctcagacaacatcggatgcaatgtaatagg |
23144965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 23145188 - 23145134
Alignment:
| Q |
1 |
caaaagatgtaattgagtcgagatgtaatcctattgtgaccactataaacagaaa |
55 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23145188 |
caaaagatgtaattgagtcgagatataatcctattgtgaccactataaacagaaa |
23145134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University