View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10471_low_5 (Length: 333)
Name: NF10471_low_5
Description: NF10471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10471_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 309; Significance: 1e-174; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 26805306 - 26805630
Alignment:
| Q |
1 |
taacaaaacataacattcatatcatcgctatcatcatggcttatccttatcaaccacaaccatctgcctctgcaccgccgatgccggtgcttccaaccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26805306 |
taacaaaacataacattcatatcatcactatcatcatggcttatccttatcaaccacaaccatctgcctctgcaccgccgatgccggtgcttccaaccac |
26805405 |
T |
 |
| Q |
101 |
catatttggccctcaatattgtgctccatatccattggatttggctgtggtcaaaaaggtgatagcaatttcagacggaaacttcgtcgtcaccgatgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26805406 |
catatttggccctcaatattgtgctccgtatccattggatttggctgtggtcaaaaaggtgatagcaatttcagacggaaacttcgtcgtcaccgatgtc |
26805505 |
T |
 |
| Q |
201 |
aacggcaatattgtcttcaaagttaaaggttctcttttaaccttccgtgaccgccgtgtcttggttgatgccgcagataaccctatcaccaccctacgtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26805506 |
aacggcaatattgtcttcaaagttaaagtttctcttttaaccttccgtgaccgccgtgtcttggttgatgccgcagataaccctatcaccaccctacgtc |
26805605 |
T |
 |
| Q |
301 |
gcaaggtaccttcaacgttcatctc |
325 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
26805606 |
gcaaggtaccttcaacgttaatctc |
26805630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 31 - 315
Target Start/End: Original strand, 26800234 - 26800518
Alignment:
| Q |
31 |
tcatcatggcttatccttatcaaccacaaccatctgcctctgcaccgccgatgccggtgcttccaaccaccatatttggccctcaatattgtgctccata |
130 |
Q |
| |
|
|||| ||||||||||||||||||||||| | || ||| ||||||||||||||||||| | || || ||||||| || | ||||||||||||||||| |
|
|
| T |
26800234 |
tcattatggcttatccttatcaaccacagcaatatgcttctgcaccgccgatgccggcacaccccactgccatattcggacagcaatattgtgctccata |
26800333 |
T |
 |
| Q |
131 |
tccattggatttggctgtggtcaaaaaggtgatagcaatttcagacggaaacttcgtcgtcaccgatgtcaacggcaatattgtcttcaaagttaaaggt |
230 |
Q |
| |
|
||| ||||||||||||| || |||||||| || | |||||||| |||||||| | |||||| |||||||||||||| || || |||||||| |||||| |
|
|
| T |
26800334 |
tccggtggatttggctgtcgtgaaaaaggttatgaccatttcagatggaaactttgccgtcactgatgtcaacggcaacatcgtgttcaaagtaaaaggt |
26800433 |
T |
 |
| Q |
231 |
tctcttttaaccttccgtgaccgccgtgtcttggttgatgccgcagataaccctatcaccaccctacgtcgcaaggtaccttcaa |
315 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||| | | |||| ||| | ||| | |||||||||||| |||||| |
|
|
| T |
26800434 |
tctctcttaaccctccgtgaccgccgtgtcttggttgatgccgctggttaccccatcgcaaccttgcgtcgcaaggtatcttcaa |
26800518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 100 - 308
Target Start/End: Original strand, 26795512 - 26795720
Alignment:
| Q |
100 |
ccatatttggccctcaatattgtgctccatatccattggatttggctgtggtcaaaaaggtgatagcaatttcagacggaaacttcgtcgtcaccgatgt |
199 |
Q |
| |
|
||||||| || ||||||||||||||||| ||||| ||||| | || ||||| ||||||||||| | ||||||||||||||||||| || || ||||| |
|
|
| T |
26795512 |
ccatattcggtcctcaatattgtgctccgtatccggtggatcttgccgtggtgaaaaaggtgatgaccatttcagacggaaacttcgctgttactgatgt |
26795611 |
T |
 |
| Q |
200 |
caacggcaatattgtcttcaaagttaaaggttctcttttaaccttccgtgaccgccgtgtcttggttgatgccgcagataaccctatcaccaccctacgt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||| ||||||| |||||||||||| ||||||| || | |||||| ||||||||||| ||| |
|
|
| T |
26795612 |
caacggcaatattgtcttcaaagttaaaggctctctcttaaccctccgtgatcgccgtgtcttgcttgatgctgctggtaaccccatcaccaccctccgt |
26795711 |
T |
 |
| Q |
300 |
cgcaaggta |
308 |
Q |
| |
|
|| |||||| |
|
|
| T |
26795712 |
cgtaaggta |
26795720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 28 - 308
Target Start/End: Original strand, 26836036 - 26836310
Alignment:
| Q |
28 |
ctatcatcatggcttatccttatcaaccacaaccatctgcctctgcaccgccgatgccggtgcttccaaccaccatatttggccctcaatattgtgctcc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||| || || ||||||||| | ||||||||||||||| |||| |
|
|
| T |
26836036 |
ctatcatcatggcttatccttatcaaccacaaccttcttcctctgcaccg---atgccaccactccccaccaccataataggccctcaatattgtactcc |
26836132 |
T |
 |
| Q |
128 |
atatccattggatttggctgtggtcaaaaaggtgatagcaatttcagacggaaacttcgtcgtcaccgatgtcaacggcaatattgtcttcaaagttaaa |
227 |
Q |
| |
|
|||||| |||| | || ||||| ||||||||||| | ||| ||||| ||||| ||| || |||||||||||||| || || ||||||||||| |
|
|
| T |
26836133 |
atatccggtggaactcgcggtggtgaaaaaggtgatgaccattgcagac---aacttaaccgttactgatgtcaacggcaacatagttttcaaagttaag |
26836229 |
T |
 |
| Q |
228 |
ggttctcttttaaccttccgtgaccgccgtgtcttggttgatgccgcagataaccctatcaccaccctacgtcgcaaggta |
308 |
Q |
| |
|
|||||| | || ||| | ||||||| |||||||||||||||||| || | |||||| |||| ||||||||||||||||||| |
|
|
| T |
26836230 |
ggttctgtgtttaccatacgtgaccaccgtgtcttggttgatgcggccggtaaccccatcatcaccctacgtcgcaaggta |
26836310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 36 - 163
Target Start/End: Original strand, 26824166 - 26824293
Alignment:
| Q |
36 |
atggcttatccttatcaaccacaaccatctgcctctgcaccgccgatgccggtgcttccaaccaccatatttggccctcaatattgtgctccatatccat |
135 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||| ||||| |
|
|
| T |
26824166 |
atggcttatccttgtcaaccacaaccatctgcctctgcaccgccgatgccggtgcttccaaccaccataatatgccctcaatattgtgatccgtatccgg |
26824265 |
T |
 |
| Q |
136 |
tggatttggctgtggtcaaaaaggtgat |
163 |
Q |
| |
|
|| ||||||| || || ||||||||||| |
|
|
| T |
26824266 |
tgaatttggccgtagtgaaaaaggtgat |
26824293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 219 - 308
Target Start/End: Original strand, 26789721 - 26789810
Alignment:
| Q |
219 |
aaagttaaaggttctcttttaaccttccgtgaccgccgtgtcttggttgatgccgcagataaccctatcaccaccctacgtcgcaaggta |
308 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||||||||||||||||||| | | |||||| |||||||||||||||||||||||| |
|
|
| T |
26789721 |
aaagtcaaaggttctctcttaaccctccgtgaccgccgtgtcttggttgatgcctccggtaaccccatcaccaccctacgtcgcaaggta |
26789810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 29 - 76
Target Start/End: Original strand, 26824087 - 26824134
Alignment:
| Q |
29 |
tatcatcatggcttatccttatcaaccacaaccatctgcctctgcacc |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26824087 |
tatcatcatggcttatccttatcaaccacaaccttctgcctctgcacc |
26824134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 26795447 - 26795488
Alignment:
| Q |
35 |
catggcttatccttatcaaccacaaccatctgcctctgcacc |
76 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
26795447 |
catggcttatccttatccagcacagccatctgcctctgcacc |
26795488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University