View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10471_low_7 (Length: 280)
Name: NF10471_low_7
Description: NF10471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10471_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 42 - 268
Target Start/End: Complemental strand, 21745562 - 21745336
Alignment:
| Q |
42 |
actactagactaaactctgggagtttatatcatctcattttcatataatgttcatcgatgatttacatatttattgattttacacattaaaaaggggcaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
21745562 |
actactagactaaactctgggagtttatatcatctcattttcatataatgttcgacgatgatttacatatttattgattttacacattaaaaaaggataa |
21745463 |
T |
 |
| Q |
142 |
tttcatcaatataaagctatattagtttgggagtgatttagatactaataattaaatgatacatttaggaaaaaagtacttaaaaattaaaggtatgttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21745462 |
tttcatcaatataaagctatattagtttgggagtgatttagatactaataattaaatgatacatttaggaaaaaagtacttaaaaattaagggtatgttt |
21745363 |
T |
 |
| Q |
242 |
gaatggatggtttaggagaggagggag |
268 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
21745362 |
gaatggatggtttaggagaggagggag |
21745336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University