View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10472_low_2 (Length: 283)
Name: NF10472_low_2
Description: NF10472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10472_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 275
Target Start/End: Original strand, 34638083 - 34638342
Alignment:
| Q |
16 |
cactattatcatgggcccgccttgcagtccatgacgttcatgtagataaaactcttgtgccagctggcacaacagcaatggtaaacatgtgggctatatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34638083 |
cactattatcatgggcccgccttgcagtccatgacgttcatgtagataaaacccttgtgccagctggcacaacagcaatggtaaacatgtgggctatatc |
34638182 |
T |
|
| Q |
116 |
tcatgactcctctatttgggaagatccattgacttttaagcccgagcgatttctaaaagaagatgtttctattatgggctcggacttgaggcttgcacct |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34638183 |
tcatgattcctctatttgggaagatccattgacttttaatccagaacgatttctaaaagaagatgtttctgttatgggctcggacttgaggcttgcacct |
34638282 |
T |
|
| Q |
216 |
tttggtgcaggtcgtagggtttgtccaggaagagccctaggcttagccacggttcatctc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34638283 |
tttggtgcaggtcgtagggtttgtccaggaagagccctaggcttagccacggttcatctc |
34638342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University