View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10473_high_16 (Length: 242)

Name: NF10473_high_16
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10473_high_16
NF10473_high_16
[»] chr5 (2 HSPs)
chr5 (17-228)||(15925635-15925846)
chr5 (103-143)||(20540118-20540158)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 15925635 - 15925846
Alignment:
17 tgtggctatagataggtttttggttcatcagtgtgcaattgtgtgatagcataattggtggtgaactttgatggaatggatcatgagattggtgtgcttt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15925635 tgtggctatagataggtttttggttcatcagtgtgcaattgtgtgatagcataattggtggtgaactttgatggaatggatcatgagattggtgtgcttt 15925734  T
117 tggtggctgttaatccttgatgttttgtttttgttagttttggaattaatggtgatattagtgttttaagctttggtctgcattattaatagttttgttc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15925735 tggtggctgttaatccttgatgttttgtttttgttagttttggaattaatggtgatattagtgttttaagctttggtctgcattattaatagttttgttc 15925834  T
217 ttctccttattg 228  Q
    ||||||||||||    
15925835 ttctccttattg 15925846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 143
Target Start/End: Original strand, 20540118 - 20540158
Alignment:
103 gattggtgtgcttttggtggctgttaatccttgatgttttg 143  Q
    ||||||| |||||| ||||||||||||||||||||||||||    
20540118 gattggtatgctttcggtggctgttaatccttgatgttttg 20540158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University