View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10473_high_16 (Length: 242)
Name: NF10473_high_16
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10473_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 15925635 - 15925846
Alignment:
| Q |
17 |
tgtggctatagataggtttttggttcatcagtgtgcaattgtgtgatagcataattggtggtgaactttgatggaatggatcatgagattggtgtgcttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15925635 |
tgtggctatagataggtttttggttcatcagtgtgcaattgtgtgatagcataattggtggtgaactttgatggaatggatcatgagattggtgtgcttt |
15925734 |
T |
 |
| Q |
117 |
tggtggctgttaatccttgatgttttgtttttgttagttttggaattaatggtgatattagtgttttaagctttggtctgcattattaatagttttgttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15925735 |
tggtggctgttaatccttgatgttttgtttttgttagttttggaattaatggtgatattagtgttttaagctttggtctgcattattaatagttttgttc |
15925834 |
T |
 |
| Q |
217 |
ttctccttattg |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15925835 |
ttctccttattg |
15925846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 143
Target Start/End: Original strand, 20540118 - 20540158
Alignment:
| Q |
103 |
gattggtgtgcttttggtggctgttaatccttgatgttttg |
143 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
20540118 |
gattggtatgctttcggtggctgttaatccttgatgttttg |
20540158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University