View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10473_high_18 (Length: 237)
Name: NF10473_high_18
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10473_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 229
Target Start/End: Complemental strand, 53713172 - 53712967
Alignment:
| Q |
24 |
gtgagatgaagattgtctcattcaaccgatgtaaaactcttttaacacaaatcaatatttttgtttttcttatttaaaaagggatcatttggtgcaaccc |
123 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53713172 |
gtgagatgaagattgtctcattcaatcgatgtaaaactcttttaacacaaatcaatatttttgtttttcttatttaaaaagggatcatttggtgcaaccc |
53713073 |
T |
|
| Q |
124 |
cgattgaggctatctatctgtgtccgctgtttgttttgatataaacgattttaggtgaagaatatgcgtgattgacaaaaacacttgaagtatgaaattg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53713072 |
cgattgaggctatctatctgtgtccgctgtttgttttgatataaacgattttaggtgaagaatatgcgtgattgacaaaaacacttgaagtatgaatatg |
53712973 |
T |
|
| Q |
224 |
atgatg |
229 |
Q |
| |
|
|||||| |
|
|
| T |
53712972 |
atgatg |
53712967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University