View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10473_high_21 (Length: 202)
Name: NF10473_high_21
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10473_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 24 - 186
Target Start/End: Complemental strand, 1543929 - 1543767
Alignment:
| Q |
24 |
agggtatccgccacctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttggttgttgaaagggtatccgccaccattgttggga |
123 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1543929 |
agggtatccaccacctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttggttgttgaaagggtatccgccaccattgttggga |
1543830 |
T |
|
| Q |
124 |
gggtaagcattgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1543829 |
gggtaagcattgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
1543767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 132 - 186
Target Start/End: Complemental strand, 32421490 - 32421436
Alignment:
| Q |
132 |
attgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
186 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32421490 |
attgttgggaggtggaccagaattctgcactggaggcctactctgcatgtctctg |
32421436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 32421700 - 32421641
Alignment:
| Q |
24 |
agggtatccgccacctgcatttggaggagcgtatccaccttgatttggaggggcatatcc |
83 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
32421700 |
agggtatccaccacctgcatttggaggagcatatccaccttgatttggaggggcgtatcc |
32421641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 128
Target Start/End: Complemental strand, 32421610 - 32421524
Alignment:
| Q |
42 |
atttggaggagcgtatccaccttgatttggaggggcatatccagcttggttgttgaaagggtatccgccaccattgttgggagggta |
128 |
Q |
| |
|
||||||||| | ||||||| |||||||||||||| ||||||||||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32421610 |
atttggaggggagtatccagattgatttggaggggagtatccagcttgattgttaggagggtatccgccagcattgttgggagggta |
32421524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 32421658 - 32421611
Alignment:
| Q |
42 |
atttggaggagcgtatccaccttgatttggaggggcatatccagcttg |
89 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
32421658 |
atttggaggggcgtatccgccttgatttggaggggcgtatccagcttg |
32421611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 89
Target Start/End: Complemental strand, 32425738 - 32425686
Alignment:
| Q |
37 |
cctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttg |
89 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| || ||| | ||||||||| |
|
|
| T |
32425738 |
cctgcatttggagaagcgtatccgccttgatttgcagaggcgtgtccagcttg |
32425686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University