View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10473_low_16 (Length: 251)
Name: NF10473_low_16
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10473_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 69 - 244
Target Start/End: Complemental strand, 46469628 - 46469453
Alignment:
| Q |
69 |
attttcagttaagatcgcatgtcttacttttaagagttgatcatgttagaattaattgcacaagttaacattttctaaataaaatatatgaacatgaata |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46469628 |
attttcagttaagatcgcatgtcttacttttaagagttgatcatgttagaattaattgcacaagttaacattttctaaataaaatatatgaacatgaata |
46469529 |
T |
 |
| Q |
169 |
taattttagaatctacgacgatgacctatcattgacgtctatataaatacttggatccatggtgaaaatgtctctg |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46469528 |
taattttagaatctacgacgatgatctatcattgacgtctatataaatacttggatccatggtgaaaatgtctctg |
46469453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University