View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10473_low_16 (Length: 251)

Name: NF10473_low_16
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10473_low_16
NF10473_low_16
[»] chr1 (1 HSPs)
chr1 (69-244)||(46469453-46469628)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 69 - 244
Target Start/End: Complemental strand, 46469628 - 46469453
Alignment:
69 attttcagttaagatcgcatgtcttacttttaagagttgatcatgttagaattaattgcacaagttaacattttctaaataaaatatatgaacatgaata 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46469628 attttcagttaagatcgcatgtcttacttttaagagttgatcatgttagaattaattgcacaagttaacattttctaaataaaatatatgaacatgaata 46469529  T
169 taattttagaatctacgacgatgacctatcattgacgtctatataaatacttggatccatggtgaaaatgtctctg 244  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
46469528 taattttagaatctacgacgatgatctatcattgacgtctatataaatacttggatccatggtgaaaatgtctctg 46469453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University