View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10473_low_25 (Length: 226)
Name: NF10473_low_25
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10473_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 34145089 - 34144888
Alignment:
| Q |
8 |
cgagagagaagaagaacagtacaatgtttcgcaatcaacaagtacaagtgtgtagttcttgtactcaccactgtagattctttgatcactttcaacgaac |
107 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34145089 |
cgagagagaataagaacagtgcaatggttcgcaatcaacaagtaaaagtgtgtagttcttgtactcaccactgtagattctttgatcactttcaacgaac |
34144990 |
T |
 |
| Q |
108 |
aaaatctacctcgcccaactctttctacaacctcatgctttatcaacgagatttccaagttttggtacttcaacatcttcctcaataatttactttcctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34144989 |
aaaatctacctcgcccaactctttctacaacctcatgctttatcaacgagatttccaagttttggtacttcaacatcttcctcaataatttactttcctt |
34144890 |
T |
 |
| Q |
208 |
tt |
209 |
Q |
| |
|
|| |
|
|
| T |
34144889 |
tt |
34144888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University