View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10474_low_8 (Length: 282)
Name: NF10474_low_8
Description: NF10474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10474_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 280
Target Start/End: Original strand, 771170 - 771436
Alignment:
| Q |
7 |
gaagcaaaggacagaagactagtgtcaaagtctattagtagtcctagtcttggtatttaacaaattatactcagatccacagttcggattcagattaatg |
106 |
Q |
| |
|
|||| ||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
771170 |
gaagaaaaggacagaacactagtgtcaaaatctattaatagtcctagtcttggtatttaacaaattatactcagatccatggttcggatt-------atg |
771262 |
T |
 |
| Q |
107 |
ggggaatggaagtggatccaattgtaatagaccagtgttttccattaccaatccactgcaggataagtggtacagatttagtcatgagagagacgcacaa |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
771263 |
ggggcgtggaagtggatccaattgtaatagaccggtgttttccattaccaatccactgcaggataagtggtacagatttagttatgtgagagacgcacac |
771362 |
T |
 |
| Q |
207 |
tctagggtatggctgttagaaattcaagtgtgtatggattggtccataaaattaaggtatttcctccgatcact |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
771363 |
tctagggtatggctgttagaaattcaagtgagtatggattagaccataaaattaaggtacttcctccgatcact |
771436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University