View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10475_high_6 (Length: 240)
Name: NF10475_high_6
Description: NF10475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10475_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 5 - 209
Target Start/End: Complemental strand, 10690165 - 10689961
Alignment:
| Q |
5 |
gaaggtgtgttcagacacgtatcagtttccagacaagtgattacattcaattatatcgttttctaaaatccttattaatctcgacgcgtcagtgttgtat |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||| |||||| || |||||||| |||| |
|
|
| T |
10690165 |
gaaggtgtgttcggacacgtatcagtttccagataagtgattacatttaattatatcgttttctaaaatcattaccaatctcaacatgtcagtgtcgtat |
10690066 |
T |
|
| Q |
105 |
ccggtgtctgcttagtataaaattacaacaaacgacataacccaacccaaccccgaaacacacaaattgcaaggaacaaaactaaaacttacgagtgaaa |
204 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10690065 |
acagtgtctgcttcatataaaattacaacaaacgacataacccaacccaaccccgaaacacacaaattgcaaggaacaaaactaaatcttacgagtgaaa |
10689966 |
T |
|
| Q |
205 |
cagtt |
209 |
Q |
| |
|
||||| |
|
|
| T |
10689965 |
cagtt |
10689961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University