View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10475_low_3 (Length: 332)
Name: NF10475_low_3
Description: NF10475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10475_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 80 - 317
Target Start/End: Original strand, 3688983 - 3689226
Alignment:
| Q |
80 |
aagtttatgatattctacagagtttgaatgattgtaaccaagggaaaaggctatagatat------atatatttaattagatcaggtaatcaaaatgata |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
3688983 |
aagtttatgatattctacagagtttgaatgattgtaaccaagggaaaaggctatagatatgtatatatatatttaatttgatcaggtaatcaaaatgata |
3689082 |
T |
|
| Q |
174 |
ataaggatgatggtatagttcataacttcatatcagatttcataaaaaagaattatcaatggccagatataattaatgtgcctagctttcannnnnnnng |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3689083 |
ataaggatgatggtatagttcataacttcatatcagatttcataaaaaagaattatcaatggccagatataattaatgtgcctagctttcattttttttg |
3689182 |
T |
|
| Q |
274 |
tgttcgtcttgttatatacatatcttgatttgaaacaaaaattg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3689183 |
tgttcgtcttgttatatacatatcttgatttgaaacaaaaattg |
3689226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University