View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10475_low_4 (Length: 311)
Name: NF10475_low_4
Description: NF10475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10475_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 126 - 227
Target Start/End: Complemental strand, 10690458 - 10690357
Alignment:
| Q |
126 |
tcacattttcctctaatttttgaatttctcaaatgtgggatactatatatgtgtcagtgttagtgttgtatctcgtgtctgtaactataactatgaagca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10690458 |
tcacattttcctctaatttttgaatttctcaaatgtgggatactatatatgtgtcagtgttagtgttgtatctcgtgtctgtaactataactatgaagca |
10690359 |
T |
|
| Q |
226 |
cg |
227 |
Q |
| |
|
|| |
|
|
| T |
10690358 |
cg |
10690357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 10690583 - 10690524
Alignment:
| Q |
1 |
atgaagtacagaaacgtaaagcacaacaccaaagatggaaaggaaaactcacttctacat |
60 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10690583 |
atgaattacagaaacgtaaagcacaacaccaaagatggaaaggaaaactcacttatacat |
10690524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 10690342 - 10690299
Alignment:
| Q |
268 |
tgacagtggcacttactctctgacaccgctaataatttgagaaa |
311 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
10690342 |
tgacagtggcacttacactcggacaccgctaataatctgagaaa |
10690299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 248
Target Start/End: Original strand, 2218225 - 2218257
Alignment:
| Q |
216 |
ctatgaagcacggatacggacacgaacatgaca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
2218225 |
ctatgaagcacggatacggacacgaacacgaca |
2218257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University